Journal: iScience

Article Title: A mechanistic basis for the malignant progression of salivary gland tumors

doi: 10.1016/j.isci.2021.103508

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam Ab13970; RRID: AB_300798 Rabbit monoclonal anti-E-cadherin (clone 24E10) Cell Signaling Technology 3195; RRID: AB_2291471 Goat polyclonal anti-HMGA2 R&D Systems AF3184 Goat polyclonal anti-SOX2 R&D Systems AF2018; RRID: AB_355110 Mouse monoclonal anti-Vimentin Developmental Studies Hybridoma Bank 40E-C; RRID: AB_528504 Rabbit polyclonal anti-Aquaporin 5 Millipore AB15858; RRID: AB_992731 Rat monoclonal anti-Keratin 19 Developmental Studies Hybridoma Bank TROMA-III; RRID: AB_2133570 Rabbit polyclonal anti-Active Caspase-3 R&D Systems AF835; RRID: AB_2243952 Rat monoclonal anti-integrin α6 (clone GoH3) BD Biosciences 555734; RRID: AB_2296273 Chemicals, peptides, and recombinant proteins 5-ethynyl-2’-deoxyuridine (EdU) ThermoFisher Scientific A10044 Tamoxifen Sigma T5648 Critical commercial assays Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye ThermoFisher Scientific C10337 Experimental models: Cell lines Lenti-X 293T cell line Takara/Clontech 632180 Experimental models: Organisms/strains Tg(tetO-HRAS)65Lc NCI Mouse Repository Stock No. 01XB4 Gt(ROSA)26Sor tm1(EYFP)Cos The Jackson Laboratory Stock No. 006148 Recombinant DNA pMD2.G Dr. Didier Trono Addgene #12259 psPAX2 Dr. Didier Trono Addgene #12260 pMB80 (R26-CreER) Dr. Tyler Jacks Addgene #12168 pmScarlet-i_C1 Dr. Dorus Gadella Addgene #85044 pLKO-PGK-rtTA-P2A-Cre This paper n/a pLKO-PGK-rtTA-P2A-Cre-SBE-NLS-mScarlet-I Taniguchi et al., 2020 n/a pLKO-PGK-rtTA-SBE-NLS-mScarlet-I-P2A-CreER This paper n/a Software and algorithms Fiji https://fiji.sc/ GraphPad Prism 9 GraphPad Software, LLC www.graphpad.com Other The Vevo2100 High-Resolution Micro-Imaging System FUJIFILM VisualSonics VS-20047 Nanoject III Auto-nanoliter injector Drummond Scientific Company 3-000-207 Open in a separate window Key resources table

Techniques: Recombinant, Imaging, Software

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Expressing, Isolation, RNA Sequencing Assay, Western Blot, Cell Culture, Derivative Assay, Infection, Binding Assay, Immunostaining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Over Expression, Staining, Infection

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: shRNA, Infection, Staining, Western Blot

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Single Vesicle Fusion Assay, Infection, Expressing, Plasmid Preparation, Staining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Recombinant, Isolation, Transgenic Assay, Software

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 1. CCPG1 Is an LIR Motif-Containing Interactor of Human ATG8 Orthologs (A) Schematic of CCPG1 structure (NTD, N-terminal amino acids 1–230; TM, transmembrane anchor). (B) GST or GST fusions of ATG8 orthologs (LC3B, LC3C, and GABARAP) were used in affinity precipitation (AP) of transfected myc-CCPG1 from HEK293 cells. (C) GST or GST-GABARAP (mtLDS, LIR-docking site mutant) were used in AP of transfected myc-CCPG1 NTD from HEK293 cells.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Transfection, Mutagenesis

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 2. CCPG1 Is a FIP200-Interacting Protein (A) A549 NTAP (FLAG-HA)-CCPG1 cells were immunoprecipitated for tagged CCPG1 using anti-HA antibody and immunoprecipitates subjected to LC-MS/MS and CompPASS analysis (see the STAR Methods and Table S1). Interacting proteins at a cut-off of WDN score 0.8 are shown here. (B) A549 cells stably expressing NTAP empty vector () or NTAP-CCPG1 (+) were immunoprecipitated for tagged CCPG1 with anti-FLAG beads and im- munoblotted for indicated proteins. (C) A549 cells were EBSS starved or left untreated for 1 hr, prior to lysis and endogenous immunoprecipitation of CCPG1 and subsequent immunoblotting (IgG, negative control IgG). (D) HEK293 cells were transfected with FLAG-FIP200 and indicated variants of full-length (FL) GFP-CCPG1 (DNTD, amino acids 231–757). Immunoprecipitation was performed with GFP-Trap and immunoblotting performed with indicated antibodies. (E) Recombinant FIP200 was incubated with either glutathione Sepharose beads alone, or with pre-purified GST or GST-CCPG1 NTD bound beads. Affinity precipitation (AP) followed by immunoblotting was then performed to assess direct interaction. See also Figure S1 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Stable Transfection, Expressing, Plasmid Preparation, Lysis, Western Blot, Negative Control, Transfection, Recombinant, Incubation

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 3. Identification of a Linear Peptide Motif in CCPG1 for Binding to FIP200 C-Terminal Region (A) A 15-mer peptide array (peptides 1–55) was probed with recombinant FIP200. Bound FIP200 was detected by indirect immunodetection. Peptide sequences corresponding to binding regions A–C are shown below the array. (B and C) HEK293 cells were transfected with FLAG-FIP200 and indicated myc-tagged deletions or truncations of CCPG1 NTD prior to anti-myc immunopre- cipitation and immunoblotting (EV, empty vector). (D) Sequence alignment of the region from amino acids 97 to 118 of human CCPG1 against vertebrate orthologs (upper) or of regions amino acids 99–113 and 17– 31 of human CCPG1 (lower). Conserved S/T and acidic residues are blue, hydrophobic residues are red. Asterisks indicate evolutionary conservation of residues. Black boxes indicate residues identical between FIR1 and FIR2. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Binding Assay, Peptide Microarray, Recombinant, Immunodetection, Transfection, Western Blot, Plasmid Preparation, Sequencing

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 4. CCPG1 Is Recruited into Autophagosomes from the ER (A) A549 cells were transfected with siCtrl or siCCPG1 and, at 24 hr post-transfection, either left untreated or starved for 1 hr in EBSS, then stained for endogenous CCPG1. Cells with CCPG1 foci were scored (n = 3, ± SEM, *p < 0.05, two-tailed paired sample t tests). Scale bar, 20 mm. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Transfection, Staining, Two Tailed Test

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 5. CCPG1 Is a UPR-Inducible Gene that Remodels the ER (A) A549 cells were treated with indicated ER stressors for 16 hr (Tun, tunicamycin, 2.5 mg/mL and Thaps, thapsigargin, 0.5 mM). qRT-PCR was performed for CCPG1 (n = 3, ± SEM, *p < 0.05, one-way ANOVA followed by Tukey’s post-hoc test). (B) HeLa cells were treated with indicated ER stressors (DTT, 0.5 or 2 mM, and Tun at 1 or 2.5 mg/mL, or Thaps at 0.5 mM) for 16 hr and then immunoblotted.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Quantitative RT-PCR

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 6. Defective Proteostasis in the Pancreas of Ccpg1 Hypomorphic Mice (A and B) Whole pancreata from littermate 6-week-old WT (+/+) or Ccpg1 hypomorphic (GT/GT) mice were immunoblotted for CCPG1 or subjected to RNA extraction and qRT-PCR for Ccpg1 (n = 3 pairs, ± SEM, ***p < 0.001, two-tailed t test). (C and D) Fifty mg of whole pancreata from littermate pairs of 6-week-old WT and Ccpg1 hypomorphic mice were homogenized in SDS. Insoluble protein was pelleted, washed and extracted in 8 M urea +10 mM DTT. Pellet samples were normalized according to protein concentration in the soluble fraction and subjected to label-free LC-MS/MS quantification. A median absolute deviation analysis is presented as a heatmap here to show species changing significantly between pairs of mice (pairs joined by connecting brackets). Secretory enzymes are in red, ER luminal chaperones/oxidoreductases are in blue. (E and F) Detergent soluble and insoluble samples prepared as above were immunoblotted and ratios of insoluble to soluble protein species obtained via densitometry (n = 3 pairs, ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed t tests). See also Figure S5 and Table S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: RNA Extraction, Quantitative RT-PCR, Two Tailed Test, Protein Concentration, Liquid Chromatography with Mass Spectroscopy

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 7. Loss of Cell Polarization and ER Homeostasis, and Consequent Tissue Injury, in Ccpg1 Hypomorphic Exocrine Pancreata (A) The acinar unit of the exocrine pancreas. Polarized acinar cells secrete condensed enzyme (zymogen) granules into ducts from their apical stores. These enzymes are initially synthesized in the expansive rough ER (rER), which occupies the basolateral regions of the cell. (B) CARS imaging or immunohistochemical staining for the ER (protein disulfide isomerase, PDI) in pancreatic tissue from 6-week-old littermate WT (+/+) or Ccpg1 hypomorphic (GT/GT) mice. Punctate CARS signals indicate protein or lipid inclusions. Scale bars, 20 mm. (C) Transmission electron microscopy (TEM) of pancreata from 6-week-old littermate pairs. Scale bar, 5 mm. Analysis of percent cytosolic area occupied by osmophilic protein granules was performed in ImageJ (n = 4 pairs, ± SEM, *p < 0.05, two-tailed t test). (D) High magnification TEM of a Ccpg1 hypomorphic mouse reveals that the rER is distended and many supernumerary inclusions are in fact intracisternal granule-like structures (arrows in zoomed inset). Scale bar, 1 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Synthesized, Imaging, Immunohistochemical staining, Staining, Transmission Assay, Electron Microscopy, Two Tailed Test